Pythium Species and Population Identification Using DNA Markers Progress Report - June 2000
June 2000 PROGRESS REPORT and APPLICATION for CONTINUED FUNDING
TITLE:
Pythium species and population identification using DNA markers
PRINCIPAL INVESTIGATOR:
Gary W. Moorman, Professor of Plant Pathology,
Department of Plant Pathology,
The Pennsylvania State University,
111 Buckhout Laboratory,
University Park, PA 16802-4506.814863-7401. gmoorman@psu.edu
CO-INVESTIGATORS:
Seogchan Kang and David Geiser,
Assistant Professors of Plant Pathology,
Penn State University,
and Seong Hwan Kim, Chief Plant Pathologist,
Pennsylvania Dept. of Agriculture,
Bureau of Plant Industry,
Harrisburg, PA.
REVIEW OF INDUSTRY NEEDS:
Knowing the identity of a pathogen and from where it came is crucial to formulating an effective management strategy for that pathogen. The research addresses this in relation to Pythium. The identification of Pythium species by using microscopic characteristics is difficult and time consuming but is important because some species are well recognized as plant pathogens, others are weak pathOgens, saprophytes or, in some cases, beneficial because they attack other parasites. It is possible that a pathogenic Pythium causing crop losses is from a resident population within a particular greenhouse or was brought in with water, potting soil or on infected plant material and is actually from a distant population. Knowing its source is important so that control measures can be instituted to eliminate or manage the pathogen at its source. The proposed research will continue work initiated in 1999 to identify genetic markers that are characteristic of Pythium species and populations within species known to infect greenhouse crops.
PROGRESS:
Objective 1. Determine DNA sequences of Pvthium that can be used to identify species within the genus.
Using PCR (polymerase chain reaction) amplification and automated DNA sequence analysis, we determined the DNA sequences of the ITS-1, 5.8s, and ITS-2 regions of nuclear ribosomal DNA for the following species and found that these sequences can be used to identify each species.
| Pythium aphanidermatum Pythium arrhenomanes Pythium catenulatuin Pythium cylindrosporum Pythiuin deliense Pythium dissotocum Pythiuum graminicola Pythium helicoides Pythium heterothalicuin Pythium irregulare |
Pythium macrosporum Pythium myriotylum Pythium spinosum Pythium splendens Pythium torulosum Pythium ultimum var. sporangiferum Pythium ultirnurn var. ultimum Pythium vanterpooli |
Phytophthora citricola Phytophthora cinnwnomi Phytophthora infestans |
Examples of the sequence information are provided (see attached). The sequences of all the isolates were aligned and compared using the DNAStar computer program. The species most often found in greenhouse samples (P. aphanidermatum, P. irregulare, and P. ultimurn) were clearly different from one another and can definitely be identified using the ITS sequences. Within P. aphanidermatum isolates and Pythium ultimum isolates, sequences differed very little from one another. However, in addition to differences observed in morphological characteristics among Pythium irregulare isolates, we found considerable variability in the DNA sequences. This ‘species’ may actually be a species complex containing closely related organisms of similar morphology but which are in the process of converging or diverging in characteristics.
Isolates were selected as ‘representatives’ of particular species and their ITS sequences aligned and a ‘tree’ created (see attached) to establish a standard database against which any other isolate can be compared. Sequences from unknowns are added to this database and then aligned to determine which known species is most like the unknown. This is a new means of identifying Pythium species and is a significant addition to the difficult task of microscopic identification and improves our ability to respond to grower problems.
The ras-related protein gene DNA sequence had never before been determined for any Pythium or PCR-amplified for Phytophthora, a related genus. We designed primers (designated ypt-. 1 and ypt-2) based on the published Phytophthora sequence (which had been obtained by means other than PCR and automated sequencing; Chen and Roxby. 1996. Gene 181:89-94) and used those primers on species of the two genera. Because we were not successful in amplifying DNA from all the Pyrhium species tried, new primers (ypt-3 and ypt-4) were designed based on the Pythium sequences that were successfully obtained. Although these primers provide useful information, another primer (ypt-5) was designed to be used in combination with ypt-1 in order to amplify an even larger segment of the gene. To date, we have determined the DNA sequences of the rasrelated protein gene for the following species:
| Pythium aphanidermatuin Pythium arrhenomanes Pythium graminicola Pythium vanterpooli |
Phytophthora infestans |
After these sequences were aligned and compared (Figure 3) it was determined that the ras sequence can also be used to identify species. We are continuing the process of searching for universal primers that can be used for all the species. Of crucial importance is identifying those primers that successfully amplify the gene in Pythium irregulare and P. ultimum. We plan to determine the ras sequences for each of the ‘representative’ species isolates as has been done for the ITS region.
We have obtained isolates of other species from researchers, extracted the DNA and will have determined the DNA sequences of the ITS regions for all the species most likely encountered in U.S. greenhouses by the end of 2000. The ras-related protein sequences will also be determined for representative species, depending upon finding suitable primers.
Developing a PCRIRFLP method of species identification is underway using the ITS region DNA. To facilitate the process, ITS sequences were entered into the DNAStar program in which enzymes can be selected that will cut the DNA at known points. By comparing the sizes of the fragments that should be formed, as indicated by the computer program, it was determined that three enzymes (Taq I, Hinf I, and Mse I) should yield fragments of that can be separated by electrophoresis and give a different pattern for P. aphanidermatum, P. irregulare, and P. ultimum. The results of this ‘virtual’ PCRJRFLP are being tested to determine that the anticipated electrophoretic patterns can be obtained in practice. Some species will not be identifiable with this technique however using the ITS DNA. For example, P. aphanidermatuin and P. deliense differ only by a few bases. Fragments resulting from enzyme. digestion of the regions are almost identical in size. Thus, the PCRIRFLP method will also be used on the rasrelated protein gene which may be better to use routinely than the ITS region. Once method perfected, identification of Pythium species using the DNA will be simpler and actual sequencing will not be required.
Objective 2. Generate DNA fingerprints, using AFLP methods, for populations within species with emphasis on P. ultimum, P. irregulare, and P. aphanidermatum, the most common species that cause significant crop losses in commercial floriculture.
Of crucial importance to this objective, we have obtained 11 isolates of P. ultirnum, 22 of P. irregulare, and 50 of P. aphanidermatum (some of the P. aphanidermatum isolates are resistant to metalaxyl). These populations are from widely separated locations and should represent well-separated populations, thereby enabling us to select the primer sets that differentiate one population from another within a given species. This initial work will be competed by May 2001.
We have identified greenhouses with histories of Pythiurn problems and have begun intensive sampling and isolations. The AFLP technique will be applied to isolates from potting mix, water, fungus gnats, shoreflies, and walkways to determine whether isolates within one operation can be differentiated from each other and whether the Pythium causing crop losses comes from one or more of these sources. The end of 2001 will complete this work.
Objective 3. Data from objectives 1 and 2 will be used to help establish an interactive Internet database linking the genotypic data to phenotypic and geographic location information on the Pythium populations
characterized in this study.
We are saving the DNA sequences on the computer for analysis and for future use in a database. Following the completion of analysis of the sequences obtained, we will submit to the World Wide Web database, BLAST, those from the ‘representative’ isolates noted in objective 1. This will be done by May 2001.
RESEARCH PRIORITIES:
1a. Complete sequencing the ITS region of representatives of additional species of Pythium that may occasionally be found in greenhouses. This is important so that a more complete database is available.
1b. Perfect the PCRIRH ,P method of identifying Pythium species. Once this is done, other researchers who do not have the equipment or expertise available to do DNA sequencing will he able to identify species using a
simplified DNA-based method.
1c. Sequence the ras-related protein region of representative species. Some common species (P. aphanidermatum) have ITS sequences so similar to other, less common ones (P. deliense) that the PCR/RFI .P method will not differentiate them. It is likely that the ras DNA of such species will differ sufficiently to allow this method to work based on the ras DNA rather than the ITS DNA.
Sequences ITS and ras 1)NA regions are also needed in order to interpret data and select particular isolates for objective 2.
2. The identification of populations within species is the single most important aspect of this research. If the geographic origin of the pathogen in a greenhouse can be determined, control measures can be directed at the source whether it is irrigation water, commercial potting mix, cuttings purchased elsewhere, or from the soil within the particular greenhouse.
3. It is important to develop a database of Pvthium populations and continually add to it so that unknowns can be compare to those that have been well characterized. It then may be possible to trace a particular pathogen to its likely source.
LIST OF SUPPLIES AND MATERIALS:
DNA extraction chemicals including DNAzoI, alcohol, and buffer salts.
DNA restriction enzymes including Taq 1. Mse 1. and Hinf I
DNA ligase enzymes
Primers for PCR work
Disposable pipet tips
Disposable nitrile (non-latex gloves)
Electrophoresis agarose and reagents.
DNA size and mass standards.
Agar, antibiotics and other reagents to isolate, purify and store Pvthium isolates.
SMALL EQUIPMENT ANTICIPATED:
2, 8-channel pipettors.
Small centrifuge rotor.
Centrifuge tube adapters.
Electrophoresis gel casting system.
AFLP glass plates (small and medium) for automatea sequencer.
3-4 repeat pipettors of various volumes.
DNA Base Sequences of the ITS-1, 5.8s, and ITS-2 Regions of Ribosomal
DNA These three species differ in DNA segment sizes as well as base sequences.
Pythium ultimum
ccAcACFTTAAAAAACrGTccAcOTGAACrGTAAOCAAGTCrAGCGCrGTGACrGAGCrGGTGrrrrCATYr1rGGACACrGGAAcGGGAGT
CAGCAGGAcGAAGG1FGGTCrGUGTAATGCAAGTTATGATGGACFAGCrGATG.\ACFTI’TGTrrVrAAACCCVrACCFAAATACFGArrTAT
ACrGTGGC,GACGAAAGTCCITGCTITTACrAGATAACAACTrTCAGCAGTGGATGTCFAGGCrCGCACATCGATGAAGAACGCrGCGAACTO
AGTOTCCGTAAATCAAACFfGCCTITC]TITFCFGTGTAGTCAGGGATOGAATGTGCAGATGTGAAGTGFCFCGCATOGTTGCaI’TCGTJTFVJ
CGATCGAGAATCTGTCakGTCDTVFAAATGGACACGGTCITFTCrATOG1TFCFATGAAGTOTAATGOTFOGAAOGCAGTGATTFTCGGATT
CICFGGCOGCITFTOGCGA(TrCGOTATGAACGTATGOAGACIACICrCAATTCGTGGTATGrrAGGCITCGGCFCGACAATGTrOCOTAATFG
GTGTG4TFCrfTGUTGTGCCrTGAGGTGTACFAGAGGTTGTCGG1TTOAACCGTAAGTGATTOTUAGTAGAGCATTUCACGATGTATGGAG
ACGCrGCA1-rTAGTTGCGTAGAGAGATrGNITFGGGAAA1TFTGTATCATTGTCAATTGCAAGATrGTGTATOGTATCI’CAA
Pythium aphanidermaturn
CCACACCFACAAACITrCCACGTGAACCGUGAAATCATOTrCTGTGCFCFCITrC000A000CrGAACOAAGGTOGGCFGCrTAATFGTAGT
CFGcGATGTATcTCAAACCCATTFACCrAATACrGATarATACrCCAAAAACGAAAG1TFATC3GTYrTAATCFATAACAACI1TCAOCAG
TOGATGTCFAGGCrcOCACATCGATGAAOAACGCFGCGAACrGCGATACGTAATGCOAATTGCAUAATTCAGTGAGTCATCG.&AATmGAA
cGcAcM-rGCACrnc000TTATGcCrGcAAGTATGCLrGTATcAGTGTcCGTAcATcAAAcTTGcOTFOTFTTCFGTGTAGTcA000AGA
GAGATGCCAGAATGTGAGGTGTCrCGCrGOCrCCC1’TTrCGOACGAGAAGACGCGAGTCCCrTrAAATGTACGFTCGCrCITTTCflGTGTCTA
AGATGAAOTGTGATTCFCGAATCGCGGTGATCrGYI’TOGATCGCmGCGCATTFGGGCGACFFCGGTI’AGGACATTAAAGGAAGCAACaFC
TATTGGCGGTATGTrAGGaTcGGCccGAcGTFGCAGCFGAcAGAGTOTCKiTITFGUGTrOTFCCnC1AGOTGTAcCFGAArrGTGTGAGOC
AATOGTCFGC3GCAATGG1rGCTGTGTAGTAGGGTm’GCFGCFCcTGGACGcCCFGTFTrOOGATAGGGTAAAGGAGQCAACACCAlTrG
GGAI’GTFTGCAATTIATTGTGAACAAO’TTCrAA
Pythium irregulare
CCACArnrAAAAAAACmCCACOTGAACFGTCGTFATTTGTFGTGTGTGTGCGCG1TGCJTAGCATGCGCG1T1’GCFFACGCFTCGOTGmG
CGAGTGCGCGTOCrGGCGGTGCGCAGACFGAACGAAGGTCGTGTGTUGCI’GrGTOCCrGCFGCACCGCFOACF1TI’GCATTGATTTGCATGA
TGTTGGCC,GAGCGGCG(xJFCICFGTGCGTGCGCCCGGCTGACCTArVrITrFCAAACCCCATAcCr.\AATGACTGATTATADGTOAGAACGA
AAGTrCrTGCrFTAAACrAGATAACAACmcACcAGTGGATGTCFAGGCFcGcAcAFcAATGAAGAAcGCFGCC,AACFGCGATAcGTAATG
CGAArrGCAAGAATTcAGTGAGTCATCGAAATTFTGAACGCATATTGCACrTCcGcJGTFATGCCFGnAAOTATGTCrGTATCAGTGTCCGTAA
ATCAAACrTGCGTrTCrrCO~FCCGTGTAGTCGOTGGAGGATCGTTGCAnATGTGAAGTGTCFCGCrGTAGTTGOCGTFCGTFGTFTGCAATGA
ATOCACAGCn’GCOAGTCO-TrrAAATGGACACGACITFCrCTmTrGTATc,TGCOCOOTGCrGTGCGTGAACGCGciTOOTTrTcOGATCGC
TCGCGGCI~COGCOACrTCGGTGAATGCATAATGGAGTGGACCrCGATTCQCGGTATGUGGGCrCGGC1’GnACAATG1TGCfl’ApTGTrG
TGTCrGTFCCGCGTICGCCI’TGAGGTGTAcTGGTGGCTGTGGGATTGAACFGGl-FACFGlTGTTAGTAGTGTGTGTGOCACGTTGTCGTGGAT
GCATGFGTGT1TrVmGCATALITFGTGTGTGCAGTrGAGcGCAGAAGAGAAGTCrCAA1TrOGGAAAAGTrnGTATACFCCGGGUUAIc
CTGCGTGTATATCTCAA
